haplogroup g origin

Haak W, Balanovsky O, Sanchez JJ et al. The forward primer is GTATTGAACTTACAATTCACGTCCC, and the reverse is CTCTCCAAATCGGGTTTCCT. Reduced genetic structure of the Iberian peninsula revealed by Y-chromosome analysis: implications for population demography. Haplogroup H Russ J Genet 2004; 40: 326331. Another notable feature is its uneven distribution. Phylogenetic relationships of studied binary markers within haplogroup G in wider context of M89-defined clade. It remains to be seen if testing will reveal G-M377 haplotypes in other populations this is some indication that G-M377 occurs at low levels in the Near East. In the G2a3b-P303 network (Figure 4), there are several region-specific clusters, indicating a considerable history for this SNP. The new phylogenetic and phylogeographic information provides additional insights into the demographic history and migratory events in Eurasia involving hg G. The present study comprises data from 98 populations totaling 17577 individuals, of which 1472 were members of hg G. The haplogroup frequency data are presented in Supplementary Table S1. The International Society of Genetic Genealogy (ISOGG) maintains the most up-to-date consensus version of haplogroup categories. [43] L240 was identified in 2009. Regueiro M, Cadenas AM, Gayden T, Underhill PA, Herrera RJ : Iran: tricontinental nexus for Y-chromosome driven migration. The most recent study (2010) estimates the common ancestor of all men in haplogroup G lived in Asia about 17,000 years ago, and the ancestor of the G2 subgroup lived about 15,000 years ago. Am J Hum Genet 2006; 78: 202221. Moreover, the accuracy and validity of the evolutionary rate has been independently confirmed in several deep-rooted Hutterite pedigrees.34 Furthermore pedigree rate-based estimates cannot be substantiated, as they are often inconsistent with dateable archeological knowledge, for example, as clearly illustrated regarding the peopling of the Americas.35 Coalescent times based on 10 STR loci (DYS19, DYS388, DYS389I, DYS389b, DYS390, DYS391, DYS392, DYS393, DYS439, DYS461-TAGA counts) and the median haplotypes of specific hg G sub-haplogroups are presented in Supplementary Table S4. Haplogroup G first locations (T. Kandell). Kharkov VN, Stepanov VA, Borinskaya SA et al. Int J Legal Med 1997; 110: 134149. L1771.1/ L177_1, L1771.2/L177_2, L177.3/L177_3) was withdrawn as an identifier by ISOGG in 2013, after it was "found to be an unreliable palindromic snp". The L141 mutation is found on the Y chromosome at 2948607. Its members include "tzi",[citation needed] the so-called Iceman, who died at least 5,000 years BP in the European Alps. So far the men positive for this have had Irish, English, Dutch, Lebanese and/or Turkish (Armenian surname) ancestry. The frequency pattern and the microsatellite network of E-M2(xM191) indicate a West African origin followed by expansion, a result that is in agreement with the findings of Cruciani et al. His male-line descendants appear to remained rooted in the region for tens of thousands of years while the Ice Age was in full swing. G2a1a persons also typically have higher values for DYS385b, such as 16, 17 or 18, than seen in most G persons. See more. Origin, Diffusion, and Differentiation of Y-Chromosome Haplogroups E "[3], Previously the National Geographic Society placed its origins in the Middle East 30,000 years ago and presumes that people carrying the haplogroup took part in the spread of the Neolithic. Concerning the presence of hg G in the Caucasus, one of its distinguishing features is lower haplogroup diversity in numerous populations (Supplementary Table S1) compared with Anatolia and Armenia, implying that hg G is intrusive in the Caucasus rather than autochthonous. Marie Lacan, Christine Keyser, Franois-Xavier Ricaut, Nicolas Brucato, Francis Duranthon, Jean Guilaine, Eric Crubzy, and Bertrand Ludes, Ancient DNA reveals male diffusion through the Neolithic Mediterranean route. The South Ossetians and Svans generally south of North Ossetia have significant number of G2a1 persons, but population percentages have not yet been provided. The Morans I coefficient was calculated using the PASSAGE software v.1.1 (Phoenix, AZ, USA) with binary weight matrix, nine distance classes and random distribution assumption. JD and JC were supported by ANR program AFGHAPOP No BLAN07-9_222301. Origin, diffusion, and differentiation of Y-chromosome haplogroups E and J: inferences on the neolithization of Europe and later migratory events in the Mediterranean area. The oldest skeletons confirmed by ancient DNA testing as carrying haplogroup G2a were five found in the Avellaner cave burial site, near Les Planes d'Hostoles, in Catalonia, Spain and were dated by radiocarbon dating to about 5000 BCE. The double 19 value situation is not seen in the G2a1 and G2a3 subclades. The most detailed SNP mutation identified was S126 (L30), which defines G2a3.[11]. Similarly, G-P16 and G-M377 networks were created using 104 P16-derived 19-locus haplotypes and 61G-M377-derived 9-locus haplotypes, with both groups representing European, Near/Middle Eastern and central/west Asian populations. A majority of members of G-P303 belong to one of its subclades, rather than to G-P303*, The largest G-P303* subclade based on available samples is one in which almost all persons have the value of 13 at STR marker DYS388. Haplogroup G-P303 - Wikipedia Chromosome Y microsatellites: population genetic and evolutionary aspects. G-P303*, also known as G2a2b2a* (previously G2a3b1*), and its subclades are now concentrated in southern Russia and the Caucasus, as well as, at lower levels, other parts of Europe and South West Asia, especially an area including Turkey, Iran and the Middle East where G2a2b2a may have originated. In contrast to its widely dispersed sister clade defined by P303, hg G-M406 has a peak frequency in Cappadocia, Mediterranean Anatolia and Central Anatolia (67%) and it is not detected in most other regions with considerable P303 frequency. Although the phylogenetic resolution within hg G has progressed,1, 17 a comprehensive survey of the geographic distribution patterns of significant hg G sub-clades has not been conducted. (Previously the name Haplogroup M was assigned to K2b1d. Ancient Migratory Events in the Middle East: New Clues from the Y King RJ, Ozcan SS, Carter T et al. It was found with burial artifacts belonging to the Linearbandkeramische Kultur ("Linear Band Ceramic Culture"; LBK). Ann Hum Genet 2004; 68: 588599. Dulik MC, Osipova LP, Schurr TG : Y-chromosome variation in Altaian Kazakhs reveals a common paternal gene pool for Kazakhs and the influence of Mongolian expansions. Although not exceeding 3% frequency overall, haplogroup G1-M285 reflects a branching event that is phylogenetically equivalent to the more widespread companion G2-P287 branch in the sense that both branches coalesce directly to the root of G-M201. PLoS Biol 2010; 8: e1000536. PLoS One 2011; 6: e17548. The suggested relevant pre-historical climatic and archeological periods specified in conjunction with lineage-specific estimated expansion times are specified in the summary portion of Supplementary Table S4. Looking still more closely at the distribution of P303 sub-clades, some distinct patterns emerge in the network (Figure 4). Drawing the history of the Hutterite population on a genetic landscape: inference from Y-chromosome and mtDNA genotypes. Provided by the Springer Nature SharedIt content-sharing initiative, European Journal of Human Genetics (2021), European Journal of Human Genetics (2020), European Journal of Human Genetics (Eur J Hum Genet) The G-M286 subclade (M286+) is small compared with G-L91. Eur J Hum Genet 2007; 15: 485493. In addition, K-Y28299, which appears to be a primary branch of K-M2313, has been found in three living individuals from India. Age Moreover, these general frequencies mostly consist of two notable lineages. . The authors declare no conflict of interest. Ancient DNA from European early neolithic farmers reveals their near eastern affinities. The Caucasus as an asymmetric semipermeable barrier to ancient human migrations. G2a2b2a is also found in India. Haplogroup G men who belong to this group, but are negative for all G2a subclades, are uncommon in Europe but may represent a sizeable group in so far poorly tested areas east of Turkey. The geographic origins of a Y chromosome haplogroup for males can be deciphered from the phylogenetic tree of mankind, or the Y-DNA Haplogroup Tree, maintained by the International Society of Genetic Genealogy ( ISOGG, 2016 ). The number of STR marker values separating men in this group suggest G-PF3359 is a relatively old group despite the small number of men involved. Haplogroup G, together with J2 clades, has been associated with the spread of agriculture, especially in the European context. The coalescence age estimate of 9400 years for P16 coincides with the early Holocene (Supplementary Table S4). Furthermore, the U1-specific sub-clade M527 is most pronounced among Ukrainians and Anatolian Greeks. The Turkish G-M377 is somewhat closer, but not identical. In the northern and highland areas of the island of Sardinia off western Italy, G percentages reach 11% of the population in one study[17] and reached 21% in the town of Tempio in another study. Semino O, Santachiara-Benerecetti AS, Falaschi F, Cavalli-Sforza LL, Underhill PA : Ethiopians and Khoisan share the deepest clades of the human Y-chromosome phylogeny. Semino O, Magri C, Benuzzi G et al. Haplogroup G-M201 - Wikipedia CAS The L293 SNP that characterizes a third subclade was identified in June 2010 at Family Tree DNA. The highest reported concentration of G1 and its subclades in a single country is in Iran, with next most frequent concentrations in neighboring countries to the west. (Behar et al., 2012b) Origin Most researchers consider the birthplace of G to have been born in East Asia. Haplogroup G ( M201) is a human Y-chromosome haplogroup. In the ten remaining populations, haplogroup diversity spanned from a low of 0.21 in Adyghes, to highs of 0.88 in Azeris (Iran) and 0.89 in eastern Anatolia and 0.90 in Armenia. Am J Hum Genet 2004; 74: 10231034. G-L14 | Haplogroup However, interpretations based on simple haplogroup frequency clines do not recognize underlying patterns of genetic diversification. The SNP L497 encompasses these men, but most G-L497 men belong to its subclade G-Z725, also known as G-DYS388=13. Important caveats to consider include the fact that Td is sensitive to authentic rare outlier alleles and that multiple founders during population formation will inflate the age estimate of the event. Zalloua PA, Xue Y, Khalife J et al. Eur J Hum Genet 2003; 11: 535542. Int J Legal Med 1997; 110: 141149. Evolutionary Biology Group, Estonian Biocentre, Tartu, Estonia, Siiri Rootsi,Mari Jrve,Ildus Kutuev,Krt Varendi,Hovhannes Sahakyan,Doron M Behar,Alena Kushniarevich&Richard Villems, Department of Psychiatry and Behavioral Sciences, Stanford University School of Medicine, Stanford, CA, USA, Department of Evolutionary Biology, Institute of Molecular and Cell Biology, University of Tartu, Tartu, Estonia, Institute of Biochemistry and Genetics, Ufa Research Center, Russian Academy of Sciences, Ufa, Russia, Ildus Kutuev,Elza K Khusnutdinova&Rita Khusainova, Departamento de Gentica, Facultad de Biologa, Universidad de La Laguna, Tenerife, Spain, Human Genetics Group, Institute of Molecular Biology, Academy of Sciences of Armenia, Yerevan, Armenia, Hovhannes Sahakyan,Levon Yepiskoposyan&Ardeshir Bahmanimehr, Research Centre for Medical Genetics, Russian Academy of Medical Sciences, Moscow, Russia, Institute for Anthropological Research, Zagreb, Croatia, Immunology department, Allergy Research Center, Shiraz University of Medical Sciences, Shiraz, Iran, Department of Human and Molecular Genetics, College of Medicine, Florida International University, Miami, FL, USA, Dipartimento di Biologia e Biotecnologie L. The P303 SNP defines the most frequent and widespread G sub-haplogroup. [10], A skeleton found at the Neolithic cemetery known as Derenburg Meerenstieg II, in Saxony-Anhalt Germany, apparently belonged to G2a3 (G-S126) or a subclade. In 2009-10, Family Tree DNA's Walk through the Y Project, sequencing certain Y-chromosome segments, provided a number of new G SNPs with the L designation. RV thanks the European Union Regional Development Fund for support through the Centre of Excellence in Genomics, the Estonian Ministry of Education and Research for the Basic Research grant SF 0270177As08. Until 2008, new G SNPs were reported from labs at the University of Arizona (P designations), Stanford University (M designations) or the University of Central Florida (U designations). The mutation is found on the Y chromosome at 10595022 and is a change from G to C. G-L30 (also G-PF3267, G-S126 or G-U8; G2a2b, previously G2a3) These five major sub-clades of the G2 branch show distinct distribution patterns over the whole area of their spread. Haplogroup G (M201) is a human Y-chromosome haplogroup. The second common hg G lineage in the Caucasus is U1, which has its highest frequencies in the South (22.8% in Abkhazians) and NW Caucasus (about 39.7% in Adyghe and 36.5% in Cherkessians), but also reaches the Near/Middle East with the highest frequency in Palestinians (16.7%) and, shows extremely low frequency in Eastern Europe. Also for P15* and L91 lineages Td estimates, DYS19 was excluded owing to duplications in these lineages.36. Eur J Hum Genet 2010; 18: 463470. On the other hand, G2a3-M485-associated lineages, or more precisely its G2a3b-P303-derived branch, represent the most common assemblage, whereas the paraphyletic G2a3-M485* lineages display overall low occurrence in the Near/Middle East, Europe and the Caucasus. In Europeexcept in Italy G2a2b1 constitutes less than 20% of G samples. G1-M285, previously described in the Iranian population . Martinez L, Underhill PA, Zhivotovsky LA et al. [39], Haplogroup G-M377 has been found at a frequency of 60% out of a sample of five Pashtuns in the Wardak region of Afghanistan. Capelli C, Brisighelli F, Scarnicci F et al. Y-chromosomal evidence of the cultural diffusion of agriculture in Southeast Europe. Origin and Migrations of Haplogroup G-M201 The first man to carry haplogroup G-M201 likely lived in southwestern Asia or the Caucasus between 46,000 and 54,000 years ago. Haplogroup definition, a set of similar haplotypes inherited together, or a group who shares a set of similar haplotypes, used to understand genetic lineages. Zhivotovsky LA, Underhill PA, Feldman MW : Difference between evolutionarily effective and germ line mutation rate due to stochastically varying haplogroup size. First, here is the only region with co-presence of deep basal branches as well as the occurrence of high sub-haplogroup diversity of haplogroup G. The genetic heritage of the earliest settlers persists both in Indian tribal and caste populations. G1 is possibly believed to have originated in Iran. [36], G-PF3359 (or G2a2b2b; previously G2a3b2) was known prior to 2013 as G-L177. This is likely due to a local founder effect.[40]. We performed principal component analysis to determine the affinities of various hg G fractions with respect to total M201 among different populations, using the frequency distributions of the following sub-clades: M285, P20, M377, M287, P287, P15*, P16, M286, M485, P303*, L497, U1*, M527, M406 and Page19. In Egypt, studies have provided information that pegs the G percentage there to be between 2% and 9%. Thank you for visiting nature.com. Rosser ZH, Zerjal T, Hurles ME et al. In Wales, a distinctive G2a3b1 type (DYS388=13 and DYS594=11) dominates there and pushes the G percentage of the population higher than in England. In addition, we introduce five new markers: M426, M461, M485, M527 and M547 (Supplementary Table S2). Two additional markers, DYS38829, 30 and DYS46131 were typed separately. G is found mostly in the north central Middle East and the Caucasus, with smaller numbers around the Mediterranean and eastward. The most probably region of the initial phase of G-M201 is estimated to be in Anatolia, Armenia or western Iran. Ann Hum Genet 2008; 72: 205214. Hg G also occurs at frequencies ranging from 5 to 15% in both the rest of Near/Middle East and southern European countries (especially Italy and Greece), with a decreasing frequency gradient towards the Balkans and northern Europe. G-L42/S146 (Y-DNA) - geni family tree In human genetics, Haplogroup G-P303 ( G2a2b2a, [2] formerly G2a3b1) is a Y-chromosome haplogroup. The second component, influenced by the relatively high presence of M377, separates Ashkenazi Jews from other populations (Figure 3a). Sengupta S, Zhivotovsky LA, King R et al. Distribution. Vernesi C, Caramelli D, Dupanloup I et al. L2b1a. Members of this group have been found in Europe and the Middle East.[3]. The hg G2a3b1c-L497 sub-cluster, on the other hand, has so far been found essentially in European populations and therefore is probably autochthonous to Europe. Conversely, hg G is present in Northeast Caucasus only at an average frequency of 5% (range 019%). Am J Hum Genet 2004; 74: 5061. Haplogroup G-M285 - Wikipedia Dulik MC, Zhadanov SI, Osipova LP et al. [16] The concentration of G falls below this average in Scandinavia, the westernmost former Soviet republics and Poland, as well as in Iceland and the British Isles. Almost all L141 men belong to L141 subclades. Categories have alternating letters and numbers. The coalescent times (Td) of various haplogroups were estimated using the ASDo methodology described by Zhivotovsky et al,32 modified according to Sengupta et al.13 We used the evolutionary effective mutation rate of 6.9 104 per 25 years, as pedigree rates are arguably only pertinent to shallow rooted familial pedigrees,33 as they do not consider the evolutionary consequences of population dynamics including the rapid extinction of newly appearing microsatellite alleles. First, the G2a1-P16 lineage is effectively Caucasus specific and accounts for about one-third of the Caucasian male gene pool (Figure 2f). Basically, haplogroups refer to organisms that have a common ancestor, identified by studying the nucleotide and mitochondrial mutations in cells. [15] Among the samples in the YHRD database from the southern Caucasus countries, 29% of the samples from Abazinia, 31% from Georgia, 2% from Azerbaijan and 18% from Armenia appear to be G samples. Am J Hum Genet 2008; 82: 873882. The highest percentage of G-P303 persons in a discrete population so far described is on the island of Ibiza off the eastern Spanish coast. Eur J Hum Genet 2004; 12: 855863. 8 Oldest Haplogroups and the Regions they Originated From Men who belong to this group but are negative for all G2 subclades represent a small number of haplogroup G men. For this are several indications. Men from the Caucasus and men from eastern Europe also form distinctive STR clusters. Y-STR haplotypes were used to construct phylogenetic networks for haplogroups G-P303, G-P16 and G-M377, using the program Network 4.6.0.0 (Fluxus-Engineering, Suffolk, England, UK) and applying the median-joining algorithm. No labs have yet assigned them shorthand names. The mutations involved may be complicated and difficult to interpret. Supplementary Information accompanies the paper on European Journal of Human Genetics website, Rootsi, S., Myres, N., Lin, A. et al. Population codes: Baltics (Blt), Belarusians (Blr), Poles (Pol), Ukrainians (Ukr), northern Russians (NRu), southern and central Russians (SRu), Circum-Uralic (CUr), Germans (Ger), Central Europeans (CE), Iberians (Ibr), French (Fra), Sardinians (Srd), Corsica (Cor), Sicilians (Sic), Italians (Ita), Switzerlands (Swi), Western Balkans (WB), Romanians (Rmn), Bulgarians (Bul), Crete (Crt), Greeks (Grc), Anatolian Greeks (AG), Egyptians (Egy), Near/Middle Easterners (ME), Ashkenazi Jews (AJ), Sephardic Jews (SJ), Arabian Peninsula (AP), Palestinians (Pal), Druze (Drz), Western Turks (WTu), Central Turks (CTu), Eastern Turks (ETu), Iranians (Irn), Abkhazians (Abh), Armenians (Arm), Georgians (Grg), South Ossetians (SOs), Iranian Azeris (Azr), Abazins (Aba), Adyghes (Ady), Balkars (Blk), Cherkessians (Crk), Kabardins (Kab), Karachays (Kar), Kuban Nogays (Nog), North Ossetians (NOs), Chamalals (Cha), Ingushes (Ing), Kumyks (Kum), Central Asians (CA), Pakistani (Pak). In other words, these mutations are so unique that they could only come from other cells with the same mutations. Nonetheless, our approach using high-resolution phylogenetic relationships as well as their phylogeography to infer the possible origin of a genetic variant provides a more plausible deduction than simply the region of highest frequency. [5] Cinnioglu et al. The non-clustering paraphyletic, hg G sub-group P303* residuals consist of samples from Near/Middle Eastern, Caucasian and European populations. Where did the haplogroup G-M201 originate? - Quora It is one of two branches of the parent haplogroup GHIJK, the other being HIJK. Am J Hum Genet 2008; 82: 236250. suggested that: "We estimate that the geographic origin of haplogroup G plausibly locates somewhere nearby eastern Anatolia, Armenia or western Iran. See: Poznik. The mutation involves a change from C to T.[citation needed] L223 is found on the Y chromosome at rs13304806. Origin. EKK thanks the Russian Academy of Sciences Program for Fundamental Research Biodiversity and dynamics of gene pools, the Ministry of Education and Science of the Russian Federation for state contracts P-325 and 02.740.11.07.01, and the Russian Foundation for Basic Research for grants 04-04-48678- and 07-04-01016-. Gene pool structure of Eastern Ukrainians as inferred from the Y-chromosome haplogroups. Semino O, Passarino G, Oefner PJ et al. G-P16 is also occasionally present in Northeast Caucasus at lower frequencies (Supplementary Table S1), consistent with a previous report.3 Outside the Caucasus, hg G-P16 occurs at 1% frequency only in Anatolia, Armenia, Russia and Spain, while being essentially absent elsewhere. Thus, these estimates should be viewed as the upper bounds of dispersal times. Paleolithic Y-haplogroup heritage predominates in a Cretan highland plateau. There are distinctive Ashkenazi Jewish and Kazakh subclades based on STR marker value combinations. Haplogroup G2a (G-P15) has been identified in Neolithic human remains in Europe dating between 5000 and 3000 BC. Because SNPs provide the most reliable method of categorization, each is allowed to represent an official G category. It is one of two branches of the parent haplogroup GHIJK, the other being HIJK . (a) Principal component analysis by population. Spallanzani, Universit di Pavia, Pavia, Italy, Viola Grugni,Vincenza Battaglia,Carmela Nici,Francesca Crobu,Sena Karachanak,Baharak Hooshiar Kashani&Ornella Semino, Department of Medical Genetics, Medical University of Sofia, Sofia, Bulgaria, National Institute of Genetic Engineering and Biotechnology (NIGEB), Tehran, Iran, Istituto di Genetica Molecolare Centro Nazionale delle Ricerche, Pavia, Italy, Centro Interdipartimentale Studi di Genere, Universit di Pavia, Pavia, Italy, Unit Mixte de Recherche 6578, Centre National de la Recherche Scientifique, and Etablissement Franais du Sang, Biocultural Anthropology, Medical Faculty, Universit de la Mditerrane, Marseille, France, Estonian Academy of Sciences, Tallinn, Estonia, Department of Biological Anthropology, University of Cambridge, Cambridge, UK, Department of Genetics, Stanford University School of Medicine, Stanford, CA, USA, You can also search for this author in The Etruscans: a population-genetic study. Here we address this issue with a phylogeographic overview of the distribution of informative G sub-clades from South/Mediterranean Europe, Near/Middle East, the Caucasus and Central/South Asia. Men with the haplogroup G marker moved into Europe in Neolithic times. New York: Columbia University Press, 1987. ), Ancient G-M201s with sequencing[self-published source?] The extreme rarity of G-M377 in northern Pakistan could indicate that G2b in this area originates outside the region and was brought there in the historic period, perhaps from further west (Pakistan was part of both the Achaemenid Persian Empire, conquered by Alexander the Great, and then formed a part of the Greco-Bactrian Kingdom). Am J Hum Genet 2007; 80: 759768. Because M201 was identified first, it is the standard SNP test used when testing for G persons. In Turkey, the South Caucasus and Iran, haplogroup G reaches the highest percentage of national populations.

Painless Bruise With White Center, Random Image Name Generator, Hampton Bay Benton Kitchen Cabinets, Charo Mcqueen Biography, Articles H